Siirt eğitim ve araştırma hastanesinde klinik örneklerden izole edilen metisiline dirençli Staphylococcus aureus suşlarının antibiyotik direnç profilleri ve metisilin direnç genlerinin araştırılması
[ X ]
Tarih
2022
Yazarlar
Dergi Başlığı
Dergi ISSN
Cilt Başlığı
Yayıncı
Siirt Üniversitesi
Erişim Hakkı
info:eu-repo/semantics/openAccess
Özet
Giriş & amaç: Metisiline dirençli Staphylococcus aureus (MRSA) suşları, insanlarda ve hayvanlarda çeşitli enfeksiyonlardan sorumlu en yaygın bakterilerden biri olarak kabul edilmektedir. Bu çalışmada Siirt Eğitim ve Araştırma Hastanesi klinik örneklerinden izole edilen metisiline dirençli S. aureus suşlarının moleküler profilini saptamayı amaçladık. Materyal-Metod: Bu çalışmada Temmuz 2020-Temmuz 2021 tarihleri arasında Siirt Eğitim ve Araştırma Hastanesine başvuran hastalardan 20 koagülaz pozitif S. aureus suşunun kültür işlemi yapılmıştır. Antibiyotik duyarlılık testi ve tanımlama işlemleri için farklı klinik örnekler kullanılmıştır. Bakteri kültürleri yapılmış ve değerlendirilmiştir. MRSA, klinik örneklerden alınan kültürler arasında tanımlanmıştır ve aşağıda nükleotid dizileri verilen evrensel primer çiftleri kullanılarak mecA-F: 5?'-CCTAGTAAAAGCTCCGGAA-3?'-mecA-R5?'-CTAGTC-CATTCGGTCCA-3?' ve mecC-F: 5?' TGTTGTAGCAATGTTCACAC 3?'-mecC-R: 5?' CAAGCACTTAATATCAACGC 3?' mecA ve mecC genleri PZR ile çoğaltılmıştır. İzole edilmiş S. aureus suşları, PZR amplifikasyonu ile evrensel primerler 68f-TNANACATGCAAGTCGRRCG-518r WTTACCGCGGC GTGCTGG kullanılarak 16S rRNA gen analizi ile akrabalık ilişkileri tanımlanmıştır. Bulgular: Bu çalışmada, Siirt Eğitim ve Araştırma Hastanesi'ne başvuran hastalardan 20 koagülaz pozitif S. aureus suşu izole edildi ve tanımlandı. 16S rRNA gen dizileri, izole edilen suşların, NCBI GenBank'ta bulunan S. aureus suşlarının 16S rRNA genlerine yüksek benzerliğe (%99-100) sahip olduğunu gösterdi. 20 suşun 18'inde mecA geni tespit edilirken, suşların hiçbirinde mecC geni tespit edilmedi. MRSA'nın yüksek bir yüzdesinin penisiline dirençli olduğu (%75) bulundu. Sonuç: Bu çalışmanın bulguları, MRSA tespitinde mecA, mecC ve 16S rRNA genlerinin önemini doğrulamış veTürkiye'de artan MRSA sıklığının yanı sıra moleküler tekniklerin epidemiyolojik bir araç olarak değerini vurgulamıştır. Anahtar Kelimeler: Gen dizilimi; Metisilin direnci; Staphylococcus aureus; 16S rRNA; mecA geni; mecC geni
Introduction and Aim: Methicillin-resistant Staphylococcus aureus (MRSA) strains are considered to be one of the most common bacteria responsible for various infections in humans and animals. In this study, it was aimed to determine the molecular profile of methicillin-resistant S. aureus strains isolated from clinical samples of Siirt Training and Research Hospital. Materials and methods: In this study, 20 coagulase positive S. aureus strains were cultured from patients admitted to Siirt Training and Research Hospital between July 2020 and July 2021. Different clinical samples were used for antibiotic susceptibility testing and identification procedures. Bacterial cultures were made and evaluated. MRSA has been identified across cultures from clinical specimens and using universal primer pairs with the following nucleotide sequences mecA-F: 5?'-CCTAGTAAAAGCTCCGGAA-3''-mecA-R5''-CTAGTC-CATTCGGTCCA-3?' and mecC-F: 5 ?' TGTTGTAGCAATGTTCACAC 3?'-mecC-R: 5?' CAAGCACTTAATATCAACGC 3?' for amplification mecA and mecC genes. Isolated S. aureus strains were identified by 16S rRNA gene analysis using universal primers 68f-TNANACATGCAAGTCGRRCG-518r WTTACCCGGC GTGCTGG by PCR amplification. Results: In this study, 20 coagulase positive S. aureus strains were isolated and identified from patients admitted to Siirt Training and Research Hospital. The 16S rRNA gene sequences showed that the isolated strains had high similarity (99-100%) to the 16S rRNA genes of S. aureus strains available in the NCBI GenBank. While the mecA gene was detected in 18 of 20 strains, the mecC gene was not detected in any of the strains. A high percentage of MRSA was found to be penicillin resistant (75%). Conclusion: The findings of this study confirmed the importance of mecA, mecC, and 16S rRNA genes in MRSA detection and emphasized the value of molecular techniques as an epidemiological tool, as well as the increasing frequency of MRSA in Turkey. Keywords: Gene sequencing; methicillin resistance, Staphylococcus aureus; 16S rRNA; the mecA gene; mecC gene
Introduction and Aim: Methicillin-resistant Staphylococcus aureus (MRSA) strains are considered to be one of the most common bacteria responsible for various infections in humans and animals. In this study, it was aimed to determine the molecular profile of methicillin-resistant S. aureus strains isolated from clinical samples of Siirt Training and Research Hospital. Materials and methods: In this study, 20 coagulase positive S. aureus strains were cultured from patients admitted to Siirt Training and Research Hospital between July 2020 and July 2021. Different clinical samples were used for antibiotic susceptibility testing and identification procedures. Bacterial cultures were made and evaluated. MRSA has been identified across cultures from clinical specimens and using universal primer pairs with the following nucleotide sequences mecA-F: 5?'-CCTAGTAAAAGCTCCGGAA-3''-mecA-R5''-CTAGTC-CATTCGGTCCA-3?' and mecC-F: 5 ?' TGTTGTAGCAATGTTCACAC 3?'-mecC-R: 5?' CAAGCACTTAATATCAACGC 3?' for amplification mecA and mecC genes. Isolated S. aureus strains were identified by 16S rRNA gene analysis using universal primers 68f-TNANACATGCAAGTCGRRCG-518r WTTACCCGGC GTGCTGG by PCR amplification. Results: In this study, 20 coagulase positive S. aureus strains were isolated and identified from patients admitted to Siirt Training and Research Hospital. The 16S rRNA gene sequences showed that the isolated strains had high similarity (99-100%) to the 16S rRNA genes of S. aureus strains available in the NCBI GenBank. While the mecA gene was detected in 18 of 20 strains, the mecC gene was not detected in any of the strains. A high percentage of MRSA was found to be penicillin resistant (75%). Conclusion: The findings of this study confirmed the importance of mecA, mecC, and 16S rRNA genes in MRSA detection and emphasized the value of molecular techniques as an epidemiological tool, as well as the increasing frequency of MRSA in Turkey. Keywords: Gene sequencing; methicillin resistance, Staphylococcus aureus; 16S rRNA; the mecA gene; mecC gene
Açıklama
Fen Bilimleri Enstitüsü, Tarımsal Biyoteknoloji Ana Bilim Dalı
Anahtar Kelimeler
Mikrobiyoloji, Microbiology, Moleküler Tıp
